snaB [2018-04-08 17:46:33]

S-(2-succino)cysteine N-acetyltransferase

Locus: BSU39510

Isoelectric point: 9.12

Molecular weight: 18.88 kDa

Protein length: 165 aa

Gene length: 495 bp

Function: utilization of S-(2-succino)cysteine

Product: S-(2-succino)cysteine N-acetyltransferase

Essential: no

Synonyms: yxeL

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Sulfur metabolism → Conversion of S-(2-succino)cysteine to cysteine
• Metabolism → Detoxification reactions

Gene

Coordinates: 4,060,307 → 4,060,804

Phenotypes of a mutant

• the snaA snaB double mutant does not grow with S-methyl cysteine PubMed
• no growth with S-(2-succino)cysteine as the single source of sulfur PubMed
• resistant to S-(2-succino)cysteine toxicity PubMed

RNA

Catalyzed reaction/ biological activity

• acetylation of S-(2-succino)cysteine PubMed

The protein

Protein family

• acetyltransferase family (according to Swiss-Prot)

Paralogous protein(s)

• SnaA

Expression and Regulation

Operons

• Genes: yxeK-snaB-yxeM-yxeN-yxeO-sndB-yxeQ
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CymR: repression, PubMed, in CymR regulon

  Regulation

  • repressed in the presence of cysteine (CymR) PubMed

  Additional information

  • the amount of the mRNA is substantially decreased upon depletion of RNase Y PubMed

Biological materials

Mutant

• MGNA-B781 (yxeL::erm), available at the NBRP B. subtilis, Japan
• BKE39510 (ΔsnaB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TCGTGGCTTCATCTAGCGTT, downstream forward: _UP4_TAAAAATAGAAAAGGCGGGA
• BKK39510 (ΔsnaB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TCGTGGCTTCATCTAGCGTT, downstream forward: _UP4_TAAAAATAGAAAAGGCGGGA

References

Loading